|
ATCC
competent cell tsingke biotech cat Competent Cell Tsingke Biotech Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tsingke+biotech/pm41894390-227-125-132?v=ATCC Average 99 stars, based on 1 article reviews
competent cell tsingke biotech cat - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
TaKaRa
primescripttm rt reagent kit takara rr037a 3 perfectstart universal green qpcr supermix transgen biotech aq631 4 primers tsingke Primescripttm Rt Reagent Kit Takara Rr037a 3 Perfectstart Universal Green Qpcr Supermix Transgen Biotech Aq631 4 Primers Tsingke, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tsingke+biotech/pmc12434922__12894_2025_1914_MOESM1_ESM-8-54-58?v=TaKaRa Average 99 stars, based on 1 article reviews
primescripttm rt reagent kit takara rr037a 3 perfectstart universal green qpcr supermix transgen biotech aq631 4 primers tsingke - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Sangon Biotech
n a etv1 i6 r5 tsingke biotech shp24072800003 megfp i1 tsingke biotech shp24060600002 i1 h1 alexa fluor488 sangon biotech order no 112875004 N A Etv1 I6 R5 Tsingke Biotech Shp24072800003 Megfp I1 Tsingke Biotech Shp24060600002 I1 H1 Alexa Fluor488 Sangon Biotech Order No 112875004, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tsingke+biotech/pm42314668-320-12-23?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
n a etv1 i6 r5 tsingke biotech shp24072800003 megfp i1 tsingke biotech shp24060600002 i1 h1 alexa fluor488 sangon biotech order no 112875004 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
dl2000 dna marker tsingke biotech cat Dl2000 Dna Marker Tsingke Biotech Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tsingke+biotech/pm40858461-295-50-59?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
dl2000 dna marker tsingke biotech cat - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Tree Star Inc
ttggtccagccaccagcttg tsingke biotech n a recombinant dna pmx ires tdtomato Ttggtccagccaccagcttg Tsingke Biotech N A Recombinant Dna Pmx Ires Tdtomato, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tsingke+biotech/pm41557504-236-1-22?v=Tree+Star+Inc Average 86 stars, based on 1 article reviews
ttggtccagccaccagcttg tsingke biotech n a recombinant dna pmx ires tdtomato - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Qiagen
rnaprep fastpure tsingke biotech Rnaprep Fastpure Tsingke Biotech, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tsingke+biotech/pmc12047471__mmc3-479-244-254?v=Qiagen Average 99 stars, based on 1 article reviews
rnaprep fastpure tsingke biotech - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Xi'an Tianlong Science
tsingke biotech Tsingke Biotech, supplied by Xi'an Tianlong Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/tsingke+biotech/pm39324728-91-10-10?v=Xi%27an+Tianlong+Science Average 90 stars, based on 1 article reviews
tsingke biotech - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |