Review





Similar Products

99
ATCC competent cell tsingke biotech cat
Competent Cell Tsingke Biotech Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tsingke+biotech/pm41894390-227-125-132?v=ATCC
Average 99 stars, based on 1 article reviews
competent cell tsingke biotech cat - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
TaKaRa primescripttm rt reagent kit takara rr037a 3 perfectstart universal green qpcr supermix transgen biotech aq631 4 primers tsingke
Primescripttm Rt Reagent Kit Takara Rr037a 3 Perfectstart Universal Green Qpcr Supermix Transgen Biotech Aq631 4 Primers Tsingke, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tsingke+biotech/pmc12434922__12894_2025_1914_MOESM1_ESM-8-54-58?v=TaKaRa
Average 99 stars, based on 1 article reviews
primescripttm rt reagent kit takara rr037a 3 perfectstart universal green qpcr supermix transgen biotech aq631 4 primers tsingke - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Sangon Biotech n a etv1 i6 r5 tsingke biotech shp24072800003 megfp i1 tsingke biotech shp24060600002 i1 h1 alexa fluor488 sangon biotech order no 112875004
N A Etv1 I6 R5 Tsingke Biotech Shp24072800003 Megfp I1 Tsingke Biotech Shp24060600002 I1 H1 Alexa Fluor488 Sangon Biotech Order No 112875004, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tsingke+biotech/pm42314668-320-12-23?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
n a etv1 i6 r5 tsingke biotech shp24072800003 megfp i1 tsingke biotech shp24060600002 i1 h1 alexa fluor488 sangon biotech order no 112875004 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

99
Thermo Fisher dl2000 dna marker tsingke biotech cat
Dl2000 Dna Marker Tsingke Biotech Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tsingke+biotech/pm40858461-295-50-59?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
dl2000 dna marker tsingke biotech cat - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Tree Star Inc ttggtccagccaccagcttg tsingke biotech n a recombinant dna pmx ires tdtomato
Ttggtccagccaccagcttg Tsingke Biotech N A Recombinant Dna Pmx Ires Tdtomato, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tsingke+biotech/pm41557504-236-1-22?v=Tree+Star+Inc
Average 86 stars, based on 1 article reviews
ttggtccagccaccagcttg tsingke biotech n a recombinant dna pmx ires tdtomato - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

99
Qiagen rnaprep fastpure tsingke biotech
Rnaprep Fastpure Tsingke Biotech, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tsingke+biotech/pmc12047471__mmc3-479-244-254?v=Qiagen
Average 99 stars, based on 1 article reviews
rnaprep fastpure tsingke biotech - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Xi'an Tianlong Science tsingke biotech
Tsingke Biotech, supplied by Xi'an Tianlong Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tsingke+biotech/pm39324728-91-10-10?v=Xi%27an+Tianlong+Science
Average 90 stars, based on 1 article reviews
tsingke biotech - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results